ID: 1112325909_1112325919

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1112325909 1112325919
Species Human (GRCh38) Human (GRCh38)
Location 13:98442702-98442724 13:98442754-98442776
Sequence CCCGAAGCGGAGGAGCAGGGAAG CCTCATCAGATCTCACCTGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 37, 4: 376} {0: 1, 1: 0, 2: 2, 3: 4, 4: 146}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!