ID: 1112344432_1112344449

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1112344432 1112344449
Species Human (GRCh38) Human (GRCh38)
Location 13:98577483-98577505 13:98577524-98577546
Sequence CCTCTGGGAAAACGCGTCCCGGG ATCGGAGTCGGGGGCACCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 63} {0: 1, 1: 0, 2: 0, 3: 5, 4: 85}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!