ID: 1112344719_1112344723

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1112344719 1112344723
Species Human (GRCh38) Human (GRCh38)
Location 13:98579508-98579530 13:98579555-98579577
Sequence CCACACTGACCATTGTTTCATCC CACCATTCTTATCGAAAGAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 251} {0: 1, 1: 0, 2: 2, 3: 7, 4: 113}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!