ID: 1112354252_1112354261

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1112354252 1112354261
Species Human (GRCh38) Human (GRCh38)
Location 13:98660991-98661013 13:98661041-98661063
Sequence CCACGAGCCATCTGTATATTCAG GGTCCTAAAGAAGGATAACAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 9, 4: 117}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!