ID: 1112374466_1112374476

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1112374466 1112374476
Species Human (GRCh38) Human (GRCh38)
Location 13:98825843-98825865 13:98825881-98825903
Sequence CCGGGGGCTGGGCTGATCCTCAG TCCTCCTCAGGCAGGCGCTATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 39, 4: 314} {0: 1, 1: 0, 2: 1, 3: 11, 4: 122}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!