ID: 1112377824_1112377831

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1112377824 1112377831
Species Human (GRCh38) Human (GRCh38)
Location 13:98860404-98860426 13:98860432-98860454
Sequence CCAATGCCGGAGATGGCGCCCAG CCTTGTGCAGGCTGTTGTCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 181} {0: 1, 1: 0, 2: 0, 3: 16, 4: 231}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!