ID: 1112381301_1112381306

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1112381301 1112381306
Species Human (GRCh38) Human (GRCh38)
Location 13:98893128-98893150 13:98893174-98893196
Sequence CCCAGTGGGTTTAGAGAAAGTCA CAGTGTAACCAGAGCGAAATCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 186} {0: 1, 1: 0, 2: 1, 3: 10, 4: 68}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!