ID: 1112381304_1112381306

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1112381304 1112381306
Species Human (GRCh38) Human (GRCh38)
Location 13:98893156-98893178 13:98893174-98893196
Sequence CCCTACTTGGCTTGAGTGCAGTG CAGTGTAACCAGAGCGAAATCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 248} {0: 1, 1: 0, 2: 1, 3: 10, 4: 68}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!