ID: 1112383756_1112383761

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1112383756 1112383761
Species Human (GRCh38) Human (GRCh38)
Location 13:98918779-98918801 13:98918793-98918815
Sequence CCCCCAAAACAAGAAAGTAGAAC AAGTAGAACAAGAAAGAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 508} {0: 1, 1: 1, 2: 10, 3: 157, 4: 1450}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!