ID: 1112416222_1112416235

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1112416222 1112416235
Species Human (GRCh38) Human (GRCh38)
Location 13:99205583-99205605 13:99205627-99205649
Sequence CCCCACCCCAGGACATTTTAATG GCAGGAGGGCAGCCACAGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 18, 4: 270} {0: 1, 1: 0, 2: 9, 3: 71, 4: 652}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!