ID: 1112466178_1112466184

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1112466178 1112466184
Species Human (GRCh38) Human (GRCh38)
Location 13:99646890-99646912 13:99646924-99646946
Sequence CCCTGCGATAGCTACTTCTCAGT CAGACACTCTTCTAGGCCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 68} {0: 1, 1: 4, 2: 19, 3: 122, 4: 669}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!