ID: 1112486979_1112486980

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1112486979 1112486980
Species Human (GRCh38) Human (GRCh38)
Location 13:99828767-99828789 13:99828814-99828836
Sequence CCTTTTCATGTCATCTTTTTTTC CACTGTGAGCCTTGCAAATATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 142, 4: 1267} {0: 1, 1: 0, 2: 1, 3: 17, 4: 137}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!