ID: 1112490493_1112490502

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1112490493 1112490502
Species Human (GRCh38) Human (GRCh38)
Location 13:99858988-99859010 13:99859027-99859049
Sequence CCCGGGTCCTTCCTTCCAGCCTG AAAGTCCTGAAGAAATCCAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 55, 4: 492} {0: 1, 1: 0, 2: 1, 3: 40, 4: 302}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!