ID: 1112494155_1112494161

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1112494155 1112494161
Species Human (GRCh38) Human (GRCh38)
Location 13:99892822-99892844 13:99892840-99892862
Sequence CCCACTTCTCTCAATTCCCACAG CACAGGAAGCCCGAGAGGTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 37, 4: 412} {0: 1, 1: 0, 2: 3, 3: 23, 4: 301}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!