ID: 1112505067_1112505078

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1112505067 1112505078
Species Human (GRCh38) Human (GRCh38)
Location 13:99970538-99970560 13:99970573-99970595
Sequence CCCCTGGGAGGTGGGGGTGGTGC TGCGCGGGCGCCGGCGGCGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 63, 4: 488} {0: 1, 1: 0, 2: 31, 3: 248, 4: 2550}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!