ID: 1112505524_1112505528

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1112505524 1112505528
Species Human (GRCh38) Human (GRCh38)
Location 13:99972312-99972334 13:99972353-99972375
Sequence CCTGCCTAGCGCTCACCTAGGGC GTGAAGAAGATAAAGTCTATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 101} {0: 1, 1: 0, 2: 2, 3: 28, 4: 238}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!