ID: 1112507472_1112507476

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1112507472 1112507476
Species Human (GRCh38) Human (GRCh38)
Location 13:99983595-99983617 13:99983608-99983630
Sequence CCCTTCCCGGGACTGTTTCCCAT TGTTTCCCATGAAATGAGTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 151} {0: 1, 1: 0, 2: 1, 3: 21, 4: 186}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!