ID: 1112540820_1112540823

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1112540820 1112540823
Species Human (GRCh38) Human (GRCh38)
Location 13:100310923-100310945 13:100310943-100310965
Sequence CCTGACGCCATTTAATAATTATG ATGTGATTTTTGGCCAAGCACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 198} {0: 1, 1: 0, 2: 9, 3: 64, 4: 592}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!