ID: 1112542099_1112542101

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1112542099 1112542101
Species Human (GRCh38) Human (GRCh38)
Location 13:100324349-100324371 13:100324372-100324394
Sequence CCTTTGAACAACACTGGTTTGAA CTGTGCAGGTCCATTTATCTTGG
Strand - +
Off-target summary {0: 6, 1: 218, 2: 627, 3: 865, 4: 940} {0: 1, 1: 1, 2: 5, 3: 10, 4: 135}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!