ID: 1112560232_1112560249

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1112560232 1112560249
Species Human (GRCh38) Human (GRCh38)
Location 13:100506328-100506350 13:100506370-100506392
Sequence CCCCCTACCAGCGCTCATTTCTG TTCGCGGGCGGGGGTGGGGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 164} {0: 1, 1: 0, 2: 16, 3: 200, 4: 1695}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!