ID: 1112561725_1112561736

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1112561725 1112561736
Species Human (GRCh38) Human (GRCh38)
Location 13:100521311-100521333 13:100521333-100521355
Sequence CCTGAAGTCCCGAGCCGGCAGCG GGGGCTGGACGGGTGGCCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 78} {0: 1, 1: 0, 2: 5, 3: 42, 4: 396}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!