ID: 1112564314_1112564321

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1112564314 1112564321
Species Human (GRCh38) Human (GRCh38)
Location 13:100539935-100539957 13:100539954-100539976
Sequence CCCGCAGGTCTAAATCGAGGTGG GTGGGGGTGTTCGGTCCTTGCGG
Strand - +
Off-target summary {0: 2, 1: 14, 2: 11, 3: 13, 4: 112} {0: 17, 1: 10, 2: 6, 3: 4, 4: 104}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!