ID: 1112565348_1112565355

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1112565348 1112565355
Species Human (GRCh38) Human (GRCh38)
Location 13:100547293-100547315 13:100547323-100547345
Sequence CCCAGACCAGAGGGGGTGGGGTA CCGCAGACACAGGGCCCTCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 146} {0: 1, 1: 1, 2: 2, 3: 28, 4: 254}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!