ID: 1112565348_1112565356

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1112565348 1112565356
Species Human (GRCh38) Human (GRCh38)
Location 13:100547293-100547315 13:100547324-100547346
Sequence CCCAGACCAGAGGGGGTGGGGTA CGCAGACACAGGGCCCTCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 146} {0: 1, 1: 0, 2: 3, 3: 29, 4: 229}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!