ID: 1112567173_1112567195

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1112567173 1112567195
Species Human (GRCh38) Human (GRCh38)
Location 13:100561703-100561725 13:100561751-100561773
Sequence CCCGGGATGCCCTTCACACCTCC GTGCTGCTCAGTGGGGGGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 35, 4: 309} {0: 1, 1: 0, 2: 3, 3: 30, 4: 278}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!