ID: 1112589042_1112589046

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1112589042 1112589046
Species Human (GRCh38) Human (GRCh38)
Location 13:100747185-100747207 13:100747217-100747239
Sequence CCTTCTAGACTCTATAAATATGG AAATAAAAAGCCCAGCTTTGGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 4, 3: 71, 4: 760}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!