ID: 1112652869_1112652881

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1112652869 1112652881
Species Human (GRCh38) Human (GRCh38)
Location 13:101417182-101417204 13:101417227-101417249
Sequence CCTCCTAAGCACCATGCCCAGGG ACTCTCTGAAAGGTTTACTTTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 19, 4: 219} {0: 1, 1: 0, 2: 1, 3: 11, 4: 187}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!