ID: 1112677724_1112677732

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1112677724 1112677732
Species Human (GRCh38) Human (GRCh38)
Location 13:101722908-101722930 13:101722935-101722957
Sequence CCCCAGGCTTCGGGACCGTTTCC CATCATGCAAAGATGGTTCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 52} {0: 1, 1: 0, 2: 0, 3: 16, 4: 154}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!