ID: 1112688929_1112688935

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1112688929 1112688935
Species Human (GRCh38) Human (GRCh38)
Location 13:101866972-101866994 13:101867003-101867025
Sequence CCACCAAAGGGGAGGCCTGGAAG CTGGAGAATCAGAAGGAAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 187} {0: 1, 1: 0, 2: 7, 3: 107, 4: 788}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!