|
Left Crispr |
Right Crispr |
| Crispr ID |
1112691348 |
1112691349 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
13:101898288-101898310
|
13:101898306-101898328
|
| Sequence |
CCTAAGCATTTCACACAAGAGAT |
GAGATACTCAACCTGTATAAAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 4, 2: 56, 3: 323, 4: 730} |
{0: 2, 1: 0, 2: 6, 3: 35, 4: 127} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|