ID: 1112698792_1112698795

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1112698792 1112698795
Species Human (GRCh38) Human (GRCh38)
Location 13:101980671-101980693 13:101980686-101980708
Sequence CCATCTTTCTCTTACCAAGTGCC CAAGTGCCAACAAGCCATCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 285} {0: 1, 1: 0, 2: 1, 3: 9, 4: 88}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!