ID: 1112714031_1112714035

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1112714031 1112714035
Species Human (GRCh38) Human (GRCh38)
Location 13:102163414-102163436 13:102163457-102163479
Sequence CCAGGGTTATAAAGGTGAGGAAA TCGAGGAAGTTTAGAGCAAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 406} {0: 1, 1: 0, 2: 0, 3: 6, 4: 81}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!