ID: 1112715708_1112715715

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1112715708 1112715715
Species Human (GRCh38) Human (GRCh38)
Location 13:102182350-102182372 13:102182385-102182407
Sequence CCCTGCCGACGCCTTGATTTTAG TGTGTTGGACTTTTGACCTCTGG
Strand - +
Off-target summary {0: 1, 1: 16, 2: 329, 3: 1499, 4: 3263} {0: 1, 1: 1, 2: 1, 3: 197, 4: 4164}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!