ID: 1112719766_1112719770

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1112719766 1112719770
Species Human (GRCh38) Human (GRCh38)
Location 13:102230149-102230171 13:102230177-102230199
Sequence CCTTGCACCATGTGAGAACACAG AGTCACTGTCTATGAGGAGTGGG
Strand - +
Off-target summary {0: 1, 1: 43, 2: 416, 3: 1048, 4: 2034} {0: 1, 1: 0, 2: 8, 3: 26, 4: 220}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!