ID: 1112725488_1112725492

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1112725488 1112725492
Species Human (GRCh38) Human (GRCh38)
Location 13:102299505-102299527 13:102299541-102299563
Sequence CCCAGCTAGCAAGCAGGCAAGAG TCAAACAGGAGTAGAACCACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 254} {0: 1, 1: 0, 2: 0, 3: 16, 4: 147}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!