ID: 1112749302_1112749318

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1112749302 1112749318
Species Human (GRCh38) Human (GRCh38)
Location 13:102566022-102566044 13:102566072-102566094
Sequence CCCTGGCCTTCCTGTCTTATCTC TTACTAGGAGCTAGGATGGAAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!