|
Left Crispr |
Right Crispr |
| Crispr ID |
1112759910 |
1112759914 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
13:102683260-102683282
|
13:102683290-102683312
|
| Sequence |
CCTGCTCGGCCTTCTGAGGAGCT |
CAGGCACGTGCCACCGCACCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 2, 2: 63, 3: 2087, 4: 20723} |
{0: 27, 1: 1423, 2: 16379, 3: 69389, 4: 173291} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|