ID: 1112763196_1112763200

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1112763196 1112763200
Species Human (GRCh38) Human (GRCh38)
Location 13:102713389-102713411 13:102713420-102713442
Sequence CCACGCCCGGCTAATTTTTGTGT AAGACGGAGTGTCACTATGTTGG
Strand - +
Off-target summary {0: 416, 1: 14564, 2: 77416, 3: 161439, 4: 156778} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!