ID: 1112834493_1112834499

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1112834493 1112834499
Species Human (GRCh38) Human (GRCh38)
Location 13:103497633-103497655 13:103497654-103497676
Sequence CCTTCCACCTCCCTCTTATAAAG AGGACCCCTGTGATTGCATCAGG
Strand - +
Off-target summary No data {0: 2, 1: 4, 2: 30, 3: 179, 4: 589}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!