ID: 1112877785_1112877789

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1112877785 1112877789
Species Human (GRCh38) Human (GRCh38)
Location 13:104066692-104066714 13:104066732-104066754
Sequence CCTAAGCGCACCCGTGCACATGC CACACATACACACGAGTGGCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 5, 3: 58, 4: 379}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!