ID: 1112966084_1112966093

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1112966084 1112966093
Species Human (GRCh38) Human (GRCh38)
Location 13:105196003-105196025 13:105196055-105196077
Sequence CCACTGTACTTATTTCCACTTAT GGTCAGGCTAATACAAATTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 270} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!