ID: 1112966102_1112966108

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1112966102 1112966108
Species Human (GRCh38) Human (GRCh38)
Location 13:105196119-105196141 13:105196171-105196193
Sequence CCAGCTGGTTGCCATGGAGAGGG CTTGTAAATTGTCATGACGCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 39, 4: 238} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!