ID: 1113014573_1113014576

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1113014573 1113014576
Species Human (GRCh38) Human (GRCh38)
Location 13:105814041-105814063 13:105814078-105814100
Sequence CCATTAAGGGGCTGATCTCATTA TGTCATTAATTGTGTGACCTGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 7, 4: 91} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!