ID: 1113074493_1113074499

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1113074493 1113074499
Species Human (GRCh38) Human (GRCh38)
Location 13:106454547-106454569 13:106454561-106454583
Sequence CCATGGCCCATCTGTCTGGGGTG TCTGGGGTGCTGGGTTGGTCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 24, 4: 318}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!