ID: 1113082326_1113082337

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1113082326 1113082337
Species Human (GRCh38) Human (GRCh38)
Location 13:106533217-106533239 13:106533270-106533292
Sequence CCTCTGGAGGCACCGGGCGGGCA GCCCGCCCGCCCGCCTCTCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 131} {0: 1, 1: 0, 2: 10, 3: 70, 4: 485}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!