ID: 1113085571_1113085582

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1113085571 1113085582
Species Human (GRCh38) Human (GRCh38)
Location 13:106567158-106567180 13:106567208-106567230
Sequence CCTTCTCTCTCCTCCTCAAGCCG TCTGCAGGCCGGCTCGCTCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 69, 4: 517} {0: 1, 1: 0, 2: 1, 3: 16, 4: 111}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!