ID: 1113086933_1113086941

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1113086933 1113086941
Species Human (GRCh38) Human (GRCh38)
Location 13:106578147-106578169 13:106578177-106578199
Sequence CCTCCCCTGGAACCTGCAGAGAG CCCTCTCGGCACCTTGATTGAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 0, 3: 36, 4: 271}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!