ID: 1113142893_1113142908

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1113142893 1113142908
Species Human (GRCh38) Human (GRCh38)
Location 13:107174701-107174723 13:107174754-107174776
Sequence CCCAGAAAAGTCTATCCAATATC AGGGAGAAGCAGGATGTGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 175} {0: 1, 1: 0, 2: 5, 3: 95, 4: 675}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!