ID: 1113148166_1113148171

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1113148166 1113148171
Species Human (GRCh38) Human (GRCh38)
Location 13:107232139-107232161 13:107232176-107232198
Sequence CCTCCTTTGCAGTCGCCATTACG CAAAGCCAAGGTAATTAGGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 27} {0: 1, 1: 0, 2: 0, 3: 6, 4: 149}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!