ID: 1113191853_1113191854

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1113191853 1113191854
Species Human (GRCh38) Human (GRCh38)
Location 13:107758063-107758085 13:107758102-107758124
Sequence CCTTCAAAAGTGACAAGAGAAAA TCTCCTCTATTCTGTTACTGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 53, 4: 610} {0: 1, 1: 0, 2: 23, 3: 118, 4: 632}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!